Review



shgfp  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Addgene inc shgfp
    Shgfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shgfp/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    shgfp - by Bioz Stars, 2026-04
    90/100 stars

    Images



    Similar Products

    shgfp  (Addgene inc)
    90
    Addgene inc shgfp
    Shgfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shgfp/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    shgfp - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    plko 1 shgfp control  (Addgene inc)
    95
    Addgene inc plko 1 shgfp control
    Plko 1 Shgfp Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 shgfp control/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    plko 1 shgfp control - by Bioz Stars, 2026-04
    95/100 stars
    		  Buy from Supplier
    plko 1 blast shgfp  (Addgene inc)
    92
    Addgene inc plko 1 blast shgfp
    Plko 1 Blast Shgfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 blast shgfp/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    plko 1 blast shgfp - by Bioz Stars, 2026-04
    92/100 stars
    		  Buy from Supplier
    control lentiviral vectors  (Addgene inc)
    92
    Addgene inc control lentiviral vectors
    Control Lentiviral Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control lentiviral vectors/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    control lentiviral vectors - by Bioz Stars, 2026-04
    92/100 stars
    		  Buy from Supplier
    plko 1 puro shgfp  (Addgene inc)
    95
    Addgene inc plko 1 puro shgfp
    Plko 1 Puro Shgfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 puro shgfp/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    plko 1 puro shgfp - by Bioz Stars, 2026-04
    95/100 stars
    		  Buy from Supplier
    gfp targeting shrna  (Addgene inc)
    93
    Addgene inc gfp targeting shrna
    Gfp Targeting Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gfp targeting shrna/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    gfp targeting shrna - by Bioz Stars, 2026-04
    93/100 stars
    		  Buy from Supplier
    canine scramble shrna sequence shgfp  (OriGene)
    90
    OriGene canine scramble shrna sequence shgfp

    Canine Scramble Shrna Sequence Shgfp, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/canine scramble shrna sequence shgfp/product/OriGene
    Average 90 stars, based on 1 article reviews
    canine scramble shrna sequence shgfp - by Bioz Stars, 2026-04
    90/100 stars
    		  Buy from Supplier
    plasmid plko 1 blast shgfp  (Addgene inc)
    92
    Addgene inc plasmid plko 1 blast shgfp

    Plasmid Plko 1 Blast Shgfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid plko 1 blast shgfp/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    plasmid plko 1 blast shgfp - by Bioz Stars, 2026-04
    92/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: P-cadherin-dependent adhesions are required for single lumen formation and HGF-mediated cell protrusions during epithelial morphogenesis

    doi: 10.1016/j.isci.2025.111844

    Figure Lengend Snippet:

    Article Snippet: Canine scramble shRNA sequence (shGFP): 5’ AAGGAAAGCACTGAAGATCTTCCCATTCG 3’ , OriGene Technologies, Inc. , N/A.

    Techniques: Recombinant, Electron Microscopy, Clinical Proteomics, Saline, Transfection, Lysis, Protease Inhibitor, Concentration Assay, Activation Assay, Sequencing, shRNA, Software, Microscopy, Cloning

    Journal: iScience

    Article Title: HHV-6B ribonucleotide reductase sequesters NF-κB subunit p65 to inhibit innate immune responses

    doi: 10.1016/j.isci.2024.111710

    Figure Lengend Snippet:

    Article Snippet: Plasmid: pLKO.1-blast shGFP , Dias et al. , Addgene, Plasmid #110419.

    Techniques: Virus, Recombinant, Protease Inhibitor, Reporter Assay, Isolation, Infection, Construct, shRNA, Expressing, Plasmid Preparation, Software, Imaging, Microscopy, Fluorescence